Dinucleotide repeat polymorphism at the SIS locus

Patterson, H., Mitchell, P. J., Cooper, C. S. ORCID: https://orcid.org/0000-0003-2013-8042 and Stratton, M. R. (1990) Dinucleotide repeat polymorphism at the SIS locus. Nucleic Acids Research, 18 (19). p. 5917. ISSN 0305-1048

Full text not available from this repository. (Request a copy)
Item Type: Article
Additional Information: Funding Information: Dinucleotide repeat sequences of the form (G-T)n are highly polymorphic and represent an important new pool of genetic markers. Using the polymerase chain reaction and primers flanking the (G-T)n region, one of which is end-labelled with y^P dATP, these polymorphic alleles can be amplified and distinguished by electrophoresis in polyacrylamide gels. Primer Sequences: AGAGGTGAATTTGCAAGTGA (GT strand); AGTGATGGTTATTACTGCAG (CA strand). PCR Conditions: PCR was carried out in a total volume of 100 /J containing 1 fig genomic DNA; 25 pmols of each primer with an additional 0.2 pmol of radiolabelled CA strand primer; 400 fM of each dNTP's; 50 mM KC1, 10 mM Tris-HCl pH 8.3, 1.5 mM MgCl2, 0.01% w/v gelatin; 2 units Taq polymerase (Cetus). Each amplification was performed for 30 cycles, 1 minute at 93°C, 1 minute at 57°C and 1 minute at 72°C. Polymorphism: PCR detects five alleles. Sequencing of two subcloned alleles revealed that the variation in size results from changes in the length of the (G-T)n region and of an adjacent (G-C)nregion. Allele Al (G-T)l2 (G-C)4 (G-A^Allele A4 (G-T)17 (G-C)4C (G-A)2 Chromosomal Localization: 4.7 kb upstream of the 'TATA' box of the c-sis proto-oncogene on chromosome 22 (1). Frequency: Allele frequencies were calculated from 28 unrelated individuals. Mendelian Inheritance: Codominant segregation was shown in 1 informative two generation family (14 individuals). AlWc Allele (bp) Frequency Al 85 064 A2 87 007 A3 89 004 A4 96 030 A3 98 003 He»crozygo*lly in our simple - 57%. Acknowledgements: We thank Bruce Ponder for DNA samples. This work was supported by grants from the Cancer Research Campaign and the Medical Research Council. References: 1) Van den Ouweland.A.M.W., van Groningen.J.J.M., Hendricksen.P.J.M., Bloemers.H.P.J. and Van de Ven,W.J.M. (1987) Nucl. Acids Res. 15,4349. 2) Litt.M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. Funding Information: Acknowledgements: We thank R.Cortese for providing a prothrombin partial cDNA clone. Supported in part by Sanofi B.V.
Uncontrolled Keywords: genetics ,/dk/atira/pure/subjectarea/asjc/1300/1311
Faculty \ School: Faculty of Medicine and Health Sciences > Norwich Medical School
UEA Research Groups: Faculty of Medicine and Health Sciences > Research Groups > Cancer Studies
Related URLs:
Depositing User: LivePure Connector
Date Deposited: 18 Jul 2022 17:31
Last Modified: 16 Jun 2026 18:06
URI: https://uea-test-2026.eprints-hosting.org/id/eprint/86550
DOI: 10.1093/nar/18.19.5917-a

Actions (login required)

View Item View Item