Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2)

Waller, Zoë A E, Howell, Lesley A, Macdonald, Colin J, O'Connell, Maria A and Searcey, Mark (2014) Identification and characterisation of a G-quadruplex forming sequence in the promoter region of nuclear factor (erythroid-derived 2)-like 2 (Nrf2). Biochemical and Biophysical Research Communications, 447 (1). pp. 128-32. ISSN 0006-291X

Full text not available from this repository.

Abstract

The transcription factor nuclear factor (erythroid-derived 2)-like 2 (Nrf2) regulates multiple antioxidants, Phase II detoxification enzymes and other cytoprotective enzymes in cells. Activation of Nrf2 is recognised as being of potential therapeutic benefit in inflammatory-diseases whereas more recently, it has become clear that the inhibition of Nrf2 may have benefit in the alleviation of resistance in some tumour types. A potential G-quadruplex forming sequence was identified in the promoter region of Nrf2, close to a number of putative transcription factor binding sites. Characterisation of the sequence 5'-d[GGGAAGGGAGCAAGGGCGGGAGGG]-3' using CD spectroscopy, imino proton NMR resonances and UV melting experiments demonstrated the formation of a parallel intramolecular G-quadruplex in the presence of K(+) ions. Incubation with 9-aminoacridine ligands induced a switch from antiparallel to parallel forms. The presence of a G-quadruplex forming sequence in the promoter region of Nrf2 suggests an approach to targeting the production of the protein through stabilisation of the structure, thereby avoiding resistance to antitumour drugs.

Item Type: Article
Additional Information: Copyright © 2014 Elsevier Inc. All rights reserved.
Uncontrolled Keywords: g-quadruplex,nrf2,9-aminoacridine,inflammation,cancer,sdg 3 - good health and well-being ,/dk/atira/pure/sustainabledevelopmentgoals/good_health_and_well_being
Faculty \ School: Faculty of Science > School of Pharmacy (former - to 2024)
Faculty of Science
UEA Research Groups: Faculty of Science > Research Groups > Medicinal Chemistry (former - to 2017)
Faculty of Science > Research Groups > Pharmaceutical Cell Biology (former - to 2017)
Faculty of Science > Research Groups > Chemical Biology and Medicinal Chemistry (former - to 2021)
Faculty of Science > Research Groups > Molecular and Tissue Pharmacology (former - to 2025)
Faculty of Science > Research Groups > Pharmacology and Biological Chemistry
Faculty of Science > Research Groups > Synthetic and Medicinal Chemistry
Depositing User: Pure Connector
Date Deposited: 12 May 2014 16:00
Last Modified: 01 Oct 2026 01:44
URI: https://uea-test-2026.eprints-hosting.org/id/eprint/48433
DOI: 10.1016/j.bbrc.2014.03.117

Actions (login required)

View Item View Item